Description of the methods used in the article with the links to references, databases and softwares used :

• Constructions :
  • Strains
  • Plasmid construction
• Physiological and microarray analyses :
  • Phenotype analyses
  • Microarrays
  • Time course studies
• Searching for Yrr1p consensus binding site :
  • Electrophoretic Mobiliy Shift Assay (EMSA)
  • Bio-informatic analyses

Strains :

For the Yrr1p gain-of-function analyses the Saccharomyces cerevisiae strains used were isogenic to SEY6210 (MATalpha leu2-3-112 ura3-52 his3-delta200 trp1-delta190 lys2-801 suc2-delta9 Mel-). The gain-of-function allele has been previously described (Zhang et al., 2001) and consist of an insertion of three HA tag in the C-terminal region of Yrr1p after the 730th amino acid (YRR1::3X HA-730). The yeast strains transformed with the fusion between YRR1 binding domain and GAL4 activating domain (called Yrr1*GAD) were from FY1679-28C (MATalpha ura3-52 trp1delta63 leu2delta1 his3delta200) and W303 (MATa ura3-52 ade2-1 leu2-3,12 his3-11,15 trp1-289) backgrounds. For the FY strain, the YRR1 deletant was provided by EUROSCARF collection and the strain is FMRN012-01A(A) (MATa ura3-52 LEU2 trp1-289 HIS3 yor162D(4, 2433)::KANMX4). For the W303 strain, the YRR1 deletant was obtained using a his6-URA3-his6 cassette and (Lu et al., 1998).

Plasmid construction :

Plasmid pCB-GAD was described previously (Devaux et al., 2001). Plasmid pCB-Yrr1*GAD was constructed by insertion in the pCB-GAD plasmid of the first 534 nucleotides of YRR1 open reading frame for the short form (named Yrr1S*GAD), or by insertion of the first 579 nucleotides of YRR1 open reading frame for the long form (named Yrr1L*GAD). These sequences were amplified by PCR using High Fidelity Taq Polymerase (Roche) and cloned at the Not I site of the pCB-GAD plasmid by homologous recombination in the FY or W303 strain used. The 5’ nucleotide used for that PCR amplification and homologous recombination is :
GACGTCCCGGACTATGCAAGGCCTGTTCCATCACACGTGAAAAGAAGAAGCGATGCTTTG
and was combined with the 3’ oligonucleotide as followed :
CTTTTTTGGAGGCTCGGGAATTAATTCCGCTGCATGTCCGGAATGTTTACTTTGTAGGTA for Yrr1S*GAD
and with the 3’ oligonucleotide as followed :
CTTTTTTGGAGGCTCGGGAATTAATTCCGCTGCATGTTGCAATTTGGGTTCTCATAGAAG for Yrr1L*GAD.
A complete oligonucleotide list in FASTA format is available.

Phenotype analyses :

Yrr1S*GAD and Yrr1L*GAD in FY and W303 strains, the YRR1 gain-of-function and the FY, W303 and SEY6210 wild type strains were grown in rich medium (1% bacto-peptone and 1% yeast extract) containing glucose (YPGlu, 2% glucose) or galactose (YPGal, 2% galactose) to an optical density at 600 nm (OD) of 0.6. Four serial 10 times dilution of this stock culture were done and plate. These plates are made for the 4-NQO and cycloheximide resistance studies by adding different drug dilution (see legend of the figures for details) to rich medium containing either glucose or galactose with 2% bacterial agar. For the oligomycin resistance analyses, the cells are plated on rich respiration medium (2% bacto-peptone, 1% yeast extract, 2% glycerol and 2% ethanol). Pictures of the plates have been taken from 3 to 5 days after plating.

Microarray experiments :

The microarrays containing all the yeast open reading frames were obtained from Hitachi Software and MWG-Biotech. For the YRR1 gain-of-function activation analyses the microarray experiments were done 6 times independently, and for Yrr1S*GAD in the FY background the experiments have been reproduced 3 independent times. The detailed microarray protocols are available on the section of Claude Jacq's laboratory dedicated to microarrays.The arrays were read using genepix 4000 A scanner from Axon and analyzed with the genepix 3.0 software.

Northern blot analyses :

Northern blot analyses were performed with total ARN extracted from the same strains as used for the microarray experiments. Yrr1S*GAD was grown first in YPGlu and shift in YPGal for different time periods from 30 minutes to 16 hours. Total RNA was extracted with the same protocol than for microarray experiments. Northern blot protocol has been described previously (Devaux et al., 2001). The probe were done using specific PCR product of each genes and were labeled using the NonaPrimer kit (Quantum-Appligene).

Electrophoretic mobility shift assay (EMSA) :

Amplification of each promoter region was done using the Expand High Fidelity PCR System (Roche) from 100 ng of genomic DNA and 40 pmol of each oligonucleotide. PCR products were purified using NucleoSpin Colunm (Machery-Nagel). Ten picomol of DNA fragments were labeled with T4 polynucleotide kinase (BioLabs) and g[32P]ATP (Amersham). The unincorporated nucleotides were removed using ProbeQuant G-50 Micro columns (Amersham). The oligonucleotide pairs used for the 200 base pair amplification of promoter genes are described in Table below. Complete oligonucleotide lists in FASTA format are available for the 200 base pair analysis and for the promoter reduction.

Total yeast protein extract was prepared from 100 ml of cell culture grown to OD600nm (600 nm) of 1.5. The cells were washed and broken in extraction buffer (100 mM Tris-HCl pH 8.0, 1 mM DTT, 20% glycerol, 1 mM PMFS and 1X protein inhibitor cocktail from Roche) with glass beads by vortexing. After a 15 minutes centrifugation at 10000 x g at 4°C, the final supernatant represent the crude extract. The binding reaction was carried out during 20 minutes at 30°C in a mix containing binding buffer (20 mM Tris-HCl pH 8.0, 5 mM MgCl2, 5 mM DTT, 5 mM CaCl2, 0.1 mM MgSO4 and 0.1 mM EDTA), 7.5% glycerol, 90 mM KCl, 0.1X Salmon sperm, 100 fmol of labeled DNA and from 1 to 5 µl of crude extract. The binding reaction mix was loaded on a 5% acrylamid/biacrylamid (29.1:0.9) gel in 1X TBE and run at 5 watts at 4°C.
The reduction of AZR1 and SNG1 promoter region was done by PCR amplification of a half of the 200 base pair region selected from the 800 upstream nucleotides. The oligonucleotides used are described in the table above.

Bio-informatic analyses :

For microarray experiments, we filtered data excluding artefactual spots, saturated spots and low signal spots. Assuming that most of the genes have unchanged expression, the Cy3/Cy5 ratios were normalized using the median of all the ratios for each experiment. We clustered the data from 6 independent experiments for the gain-of-function and 3 independent experiments with the chimera using PCA module of J-express (Dysvik and Jonassen, 2001). The cluster of Figure 9 was generated using Treeview software (Eisen et al., 1998). The profiles of genes belonging to up- and down-regulated clusters were visually checked and genes with non-regular profiles were discarded. For 200 base pair selection in the promoter (between –800 and +1) of the up-regulated genes we used the Consensus module of RSA tools (van Helden et al., 2000). For the consensus search in the regulated genes exhibiting a specific DNA binding we used the Motif Sampler online software (Thijs et al., 2001). The consensus sequences found were then aligned and represented using Sequence logo (Schneider and Stephens, 1990). The final global PDR network was designed using the data providing by Yeast Proteome Database (YPD, Costanzo et al., 2001) and yeast Microarray Global Viewer (yMGV, Marc et al., 2001) for the analysis of published data on yeast microarray results.